graphpad prime 5.0 Search Results


90
GraphPad Software Inc graphpad prime5
Graphpad Prime5, supplied by GraphPad Software Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/graphpad prime5/product/GraphPad Software Inc
Average 90 stars, based on 1 article reviews
graphpad prime5 - by Bioz Stars, 2026-05
90/100 stars
  Buy from Supplier

90
GraphPad Software Inc prim software
Prim Software, supplied by GraphPad Software Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/prim software/product/GraphPad Software Inc
Average 90 stars, based on 1 article reviews
prim software - by Bioz Stars, 2026-05
90/100 stars
  Buy from Supplier

90
GraphPad Software Inc ec 20 /ec 50 values
Ec 20 /Ec 50 Values, supplied by GraphPad Software Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/ec 20 /ec 50 values/product/GraphPad Software Inc
Average 90 stars, based on 1 article reviews
ec 20 /ec 50 values - by Bioz Stars, 2026-05
90/100 stars
  Buy from Supplier

90
GraphPad Software Inc nonlinear regression graphpad prim 5.0
Nonlinear Regression Graphpad Prim 5.0, supplied by GraphPad Software Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/nonlinear regression graphpad prim 5.0/product/GraphPad Software Inc
Average 90 stars, based on 1 article reviews
nonlinear regression graphpad prim 5.0 - by Bioz Stars, 2026-05
90/100 stars
  Buy from Supplier

90
GraphPad Software Inc graphpad prim 8
Graphpad Prim 8, supplied by GraphPad Software Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/graphpad prim 8/product/GraphPad Software Inc
Average 90 stars, based on 1 article reviews
graphpad prim 8 - by Bioz Stars, 2026-05
90/100 stars
  Buy from Supplier

90
GraphPad Software Inc graphpad prim5.0 software
Graphpad Prim5.0 Software, supplied by GraphPad Software Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/graphpad prim5.0 software/product/GraphPad Software Inc
Average 90 stars, based on 1 article reviews
graphpad prim5.0 software - by Bioz Stars, 2026-05
90/100 stars
  Buy from Supplier

90
GraphPad Software Inc prims 8.4.2 software
Prims 8.4.2 Software, supplied by GraphPad Software Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/prims 8.4.2 software/product/GraphPad Software Inc
Average 90 stars, based on 1 article reviews
prims 8.4.2 software - by Bioz Stars, 2026-05
90/100 stars
  Buy from Supplier

90
GraphPad Software Inc prims 2.01
Prims 2.01, supplied by GraphPad Software Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/prims 2.01/product/GraphPad Software Inc
Average 90 stars, based on 1 article reviews
prims 2.01 - by Bioz Stars, 2026-05
90/100 stars
  Buy from Supplier

90
GraphPad Software Inc prim 6.0
Prim 6.0, supplied by GraphPad Software Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/prim 6.0/product/GraphPad Software Inc
Average 90 stars, based on 1 article reviews
prim 6.0 - by Bioz Stars, 2026-05
90/100 stars
  Buy from Supplier

88
Addgene inc caaggagctgactgtcatctgg 30 thermofisher n a primer pxdn
Caaggagctgactgtcatctgg 30 Thermofisher N A Primer Pxdn, supplied by Addgene inc, used in various techniques. Bioz Stars score: 88/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/caaggagctgactgtcatctgg 30 thermofisher n a primer pxdn/product/Addgene inc
Average 88 stars, based on 1 article reviews
caaggagctgactgtcatctgg 30 thermofisher n a primer pxdn - by Bioz Stars, 2026-05
88/100 stars
  Buy from Supplier

90
GraphPad Software Inc prims 6.0 software
a Western blotting analysis of P-gp expression in MCF-7/ADR and SK-BR-3/EPR cells transfected with negative control or Rack1-specific siRNAs; β-actin was used as a loading control. b Knockdown of Rack1 in two MDR cells enhanced the sensitivity to EPI in comparison with control cells. Cells were treated with different concentrations of EPI and the cell viability was determined by a CCK8-based assay. The assay was performed in triplicates for each EPI concentration and repeated thrice. IC 50 was calculated by using the GraphPad Prims 6.0 software. c Knockdown of Rack1 in two drug-resistant cells increases cellular Rh123 retention in comparison with wild-type and control cells as measured by flow cytometry. d Knockdown of Rack1 in two drug-resistant cells decreases the efflux rate of Rh123 compared with control cells. Cells were incubated in Rh123 dye-containing medium for 30 min, then washed with PBS, and incubated in Rh123-free medium for 0, 15, 30, 45, and 60 min. At each time point, cells were immediately detected by using flow cytometry. The assays were carried out in triplicate and repeated three times. Data were shown as mean ± SD, **** P < 0.0001 vs. siControl in MDR cells, statistical analysis was performed by two-way ANOVA. e Knockdown of Rack1 in MDR cells increased cellular EPI retention compared with control cells. Cells were initially incubated with 2 μM of EPI for 2 h and then incubated with EPI-free medium for additional 1 h. Afterward, the cells were counterstained with 1.0 ng/mL of DAPI for nuclei. Images were captured by fluorescence microscope. f Quantification of EPI fluorescence intensity in Fig. 1e by using Image J (NIH, Bethesda, MD, USA) software. *** P < 0.001 vs. siControl, data are presented as mean ± SD, statistical analysis was calculated by two-way ANOVA
Prims 6.0 Software, supplied by GraphPad Software Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/prims 6.0 software/product/GraphPad Software Inc
Average 90 stars, based on 1 article reviews
prims 6.0 software - by Bioz Stars, 2026-05
90/100 stars
  Buy from Supplier

Image Search Results


a Western blotting analysis of P-gp expression in MCF-7/ADR and SK-BR-3/EPR cells transfected with negative control or Rack1-specific siRNAs; β-actin was used as a loading control. b Knockdown of Rack1 in two MDR cells enhanced the sensitivity to EPI in comparison with control cells. Cells were treated with different concentrations of EPI and the cell viability was determined by a CCK8-based assay. The assay was performed in triplicates for each EPI concentration and repeated thrice. IC 50 was calculated by using the GraphPad Prims 6.0 software. c Knockdown of Rack1 in two drug-resistant cells increases cellular Rh123 retention in comparison with wild-type and control cells as measured by flow cytometry. d Knockdown of Rack1 in two drug-resistant cells decreases the efflux rate of Rh123 compared with control cells. Cells were incubated in Rh123 dye-containing medium for 30 min, then washed with PBS, and incubated in Rh123-free medium for 0, 15, 30, 45, and 60 min. At each time point, cells were immediately detected by using flow cytometry. The assays were carried out in triplicate and repeated three times. Data were shown as mean ± SD, **** P < 0.0001 vs. siControl in MDR cells, statistical analysis was performed by two-way ANOVA. e Knockdown of Rack1 in MDR cells increased cellular EPI retention compared with control cells. Cells were initially incubated with 2 μM of EPI for 2 h and then incubated with EPI-free medium for additional 1 h. Afterward, the cells were counterstained with 1.0 ng/mL of DAPI for nuclei. Images were captured by fluorescence microscope. f Quantification of EPI fluorescence intensity in Fig. 1e by using Image J (NIH, Bethesda, MD, USA) software. *** P < 0.001 vs. siControl, data are presented as mean ± SD, statistical analysis was calculated by two-way ANOVA

Journal: Cell Death & Disease

Article Title: Rack1 mediates Src binding to drug transporter P-glycoprotein and modulates its activity through regulating Caveolin-1 phosphorylation in breast cancer cells

doi: 10.1038/s41419-019-1633-y

Figure Lengend Snippet: a Western blotting analysis of P-gp expression in MCF-7/ADR and SK-BR-3/EPR cells transfected with negative control or Rack1-specific siRNAs; β-actin was used as a loading control. b Knockdown of Rack1 in two MDR cells enhanced the sensitivity to EPI in comparison with control cells. Cells were treated with different concentrations of EPI and the cell viability was determined by a CCK8-based assay. The assay was performed in triplicates for each EPI concentration and repeated thrice. IC 50 was calculated by using the GraphPad Prims 6.0 software. c Knockdown of Rack1 in two drug-resistant cells increases cellular Rh123 retention in comparison with wild-type and control cells as measured by flow cytometry. d Knockdown of Rack1 in two drug-resistant cells decreases the efflux rate of Rh123 compared with control cells. Cells were incubated in Rh123 dye-containing medium for 30 min, then washed with PBS, and incubated in Rh123-free medium for 0, 15, 30, 45, and 60 min. At each time point, cells were immediately detected by using flow cytometry. The assays were carried out in triplicate and repeated three times. Data were shown as mean ± SD, **** P < 0.0001 vs. siControl in MDR cells, statistical analysis was performed by two-way ANOVA. e Knockdown of Rack1 in MDR cells increased cellular EPI retention compared with control cells. Cells were initially incubated with 2 μM of EPI for 2 h and then incubated with EPI-free medium for additional 1 h. Afterward, the cells were counterstained with 1.0 ng/mL of DAPI for nuclei. Images were captured by fluorescence microscope. f Quantification of EPI fluorescence intensity in Fig. 1e by using Image J (NIH, Bethesda, MD, USA) software. *** P < 0.001 vs. siControl, data are presented as mean ± SD, statistical analysis was calculated by two-way ANOVA

Article Snippet: IC 50 was calculated by using the GraphPad Prims 6.0 software. c Knockdown of Rack1 in two drug-resistant cells increases cellular Rh123 retention in comparison with wild-type and control cells as measured by flow cytometry. d Knockdown of Rack1 in two drug-resistant cells decreases the efflux rate of Rh123 compared with control cells.

Techniques: Western Blot, Expressing, Transfection, Negative Control, CCK-8 Assay, Concentration Assay, Software, Flow Cytometry, Incubation, Fluorescence, Microscopy